Transferability of Rubus Microsatellite Markers to Black Raspberry

Microsatellite or simple sequence repeat (SSR) markers have been developed from genomic and expressed sequence tag (EST) libraries in red raspberry (Rubus idaeus, subgenus Idaeobatus) and also in blackberry (Rubus subgenus Rubus). Recently, there has also been increased interest in the use of SSR markers in black raspberry (R. occidentalis subgenus Idaeobatus) to aid in the identification and characterization of new sources of genetic diversity for breeding, and to aid in the development of a core collection of the 208 seed and clonal accessions at the US Department of Agriculture, Agricultural Research Service, National Clonal Germplasm Repository in Corvallis, Oregon. The objective of this study was to determine the suitability of SSR markers developed in other Rubus species for use in black raspberry. Amplification and optimum annealing temperatures of 112 Rubus SSR primer pairs were determined in the black raspberry ‘Munger’ by gradient polymerase chain reaction. A panel of 15 cultivars and wild black raspberry accessions was used to evaluate these SSR primers for polymorphism, using 3% agarose gel electrophoresis. This led to the identification of 27 primer pairs that appeared to generate polymorphic markers. Marker quality and genetic relationships were evaluated by fragment analysis in 12 cultivated and 4 wild genotypes using 20 of these markers after separation by capillary electrophoresis. INTRODUCTION Black raspberry (Rubus occidentalis L. subgenus Idaeobatus) production in the United States is limited by a lack of suitable cultivars and little progress in breeding new cultivars has been made in the last 40 years because of a lack of phenotypic variation in available germplasm. This problem has received relatively little attention until recent years with renewed interest in understanding and finding new sources of black raspberry diversity for breeding improved cultivars. Weber (2003) used randomly amplified polymorphic DNA (RAPD) markers to distinguish between 14 cultivated and 2 wild black raspberry genotypes. While this work has yielded valuable information about the apparent lack of variability and relationships between black raspberry cultivars, RAPD markers lack the reproducibility desired for genetic fingerprinting and large scale population studies. Simple sequence repeat (SSR) or microsatellite markers are robust, highly polymorphic, codominant markers with applications in population genetics, genetic diversity studies and DNA fingerprinting. Microsatellite markers would be useful for cultivar identification and genetic diversity studies in black raspberry but have not yet been developed in this taxon. Microsatellite markers have been developed from expressed sequence tag (EST) and genomic libraries in both red raspberry (Rubus idaeus L. subgenus Idaeobatus) and blackberry (Rubus L. subgenus Rubus). The objective of this a [email protected] b [email protected] c [email protected] Proc. IS on Molecular Markers in Horticulture Eds.: N.V. Bassil and R. Martin Acta Hort. 859, ISHS 2010 104 study was to identify Rubus microsatellite primers that successfully amplify products in black raspberry, evaluate them for polymorphism, and learn about their utility. MATERIALS AND METHODS DNA was extracted from freshly growing tissue of 12 black raspberry cultivars (‘Black Hawk’, ‘Black Knight’, ‘Bristol’, ‘Dundee’, ‘Hanover’, ‘Haut’, ‘John Robertson’, ‘Jewel’, ‘Mac Black’, ‘Munger’, ‘New Logan’, and ‘Plum Farmer’) and four wild accessions (ORUS 3802 Lexington, Kentucky; ORUS 3902 Smithville, Tennessee; ORUS 4138 Chadron, Nebraska; and ORUS 3821 Camden, Maine) using a modified PureGene kit (Gentra). Tissue from the 12 black raspberry cultivars was collected from plants at the USDA-ARS National Clonal Germplasm Repository screenhouse collection. The four wild accessions were randomly chosen seedlings from seed collected from plants growing wild at the locations indicated. Rubus SSR primer sequences were selected from published reports in red raspberry (Graham et al., 2004) and blackberry (Castillo, 2006; Lewers et al., 2008; Lopes et al., 2006). The previously unreported primer Rub1C6 was also included in this analysis. Rub1C6 was developed from a genomic library of the blackberry ‘Marion’ (forward primer: TCTGCCTCTGCATTTTACACAG, reverse primer: TAGGTAAGCAATGGGAAAGCTC). The amplification and optimum annealing temperatures for 112 Rubus primer pairs was determined by gradient polymerase chain reaction (PCR) from 50 to 65°C in the cultivar ‘Munger.’ After an initial denaturation at 94°C for 3 min, DNA was amplified for 35 cycles in a PTC-225 gradient thermal cycler programmed for a 40 s denaturation step at 94°C, a 40 s annealing step at the optimum annealing temperature of the primer pair and a 40 s extension step at 72°C. A final extension step was included at 72°C for 30 min. Nonfluorescent PCR reactions were performed in a volume of 10 μl. PCR products from 12 black raspberry cultivars and three wild accessions were visualized on a 3% agarose gel run at 120 V for 2.5 h in TBE buffer and then stained with ethidium bromide. Primer pairs appearing to amplify polymorphic products were reamplified with fluorescently labeled forward primers. Instead of fluorescently labeling all forward primers, the M13 sequence TGTAAAA CGACGGCCAGT was added to the forward primer of some (Table 1) and a fluorescently (WellRed D2, D3 and D4; purchased from Integrated DNA Technologies, Inc. San Diego, California) labeled M13 primer was used, following the procedure outlined by Schuelke et al. (2000). Fluorescently labeled PCR products were separated by capillary electrophoresis using the Beckman CEQ 8000 genetic analyzer (Beckman-Coulter) in 12 cultivars and 4 wild genotypes. The data were then compiled and analyzed with PowerMarker (Liu and Muse, 2005) and a phylogenetic tree was constructed based on the calculated shared allele distance using unweighted pair-group method analysis (UPGMA). RESULTS AND DISCUSSION Of the 112 Rubus primer pairs examined by 3% gel electrophoresis, 27 were tentatively selected as polymorphic and were examined further by capillary electrophoresis. Of these 27 primer pairs, three were excluded from further analysis because they appeared to amplify multiple loci, two were excluded because they were considered too difficult to score accurately, and two were excluded because they proved to be monomorphic. The quality of the remaining 20 primers varied widely. In the 12 cultivars and four wild genotypes studied, they amplified between 2 and 9 alleles and observed rates of heterozygosity ranged from 0 to 0.81. Allele number, heterozygosity, and polymorphism information content (PIC) of these 20 Rubus SSR primer pairs are summarized in Table 1. The 20 SSR primer pairs studied were unable to distinguish between the cultivars ‘Munger’ and ‘New Logan’. This result is not entirely surprising. In his study of black raspberry diversity using RAPD markers and the same plant material as in our study, Weber (2003) found 98% similarity between these two cultivars. While it is possible that these two cultivars cannot be distinguished using the SSR primers in this study, this result